Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ649659
Length 319 bp
Fasta Format > whem17n17
atggccacaccactcatagctggacttgctgtggcagccactgctcttgc gggtagatatggcatccaggcttggcaagcttacaaggcaaggcccatag ttccaaggatgcgtaaattctatgaaggtggctttcaagctacaatgacc cgacgggaagctggtctaatcttgggtatcagggaaaacgtccgtcctga taaggtgaaagaggcacacaagagggtcatggttgccaatcacccggatg caggaggaagccattaccttgcgtcnaagatcaacgaggcaaaagatgtt ttgctggggaaaactaaag
Download
page-top