Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ649633
Length 613 bp
Fasta Format > whem17l08
agccatcaaaactgactacaaagttcacgacacccaggtggcacatatat catcttctagatatgaagcagcaaaatagcgacttctattttctactcag cagcagcaacctcctccgctccaggaatcacctcatctccatcagcaggc ctgtcaagcttcacaccaacatcctccttgtagtcaccgtgcacctccat gagcttccccaggtcaaacttgggggccttcaggatcttcaccttgcgga cgtacacgttctggagggggaagatgcttgaggtggccttctcaatctcc tttccaatcacctcagggatgaacttgttcacaagctccttcaagtcaca gcttgcagcttggttgaccatgatctcaaccatcttgcggcggatctgtc tgatctgacttgcttgggcatagcaagtgcgcttcacctggtttgggcgt ctcttcgtgaagccaatggtgaacatgcggagcatgtagttgtcagtggt cttcacatccacatgagcctcaatgagtgtctgccacttcctcacaanag acctgagcttgtcagtggtgaagtccatgccccanaagtttgngaggaca ttnntcccttgca
Download
page-top