Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ649628
Length 240 bp
Fasta Format > whem17k23
gaagtctgccaggcctcctggccgcccactcggttctggcccacctggtg accgcccaagggggccacctcgctttgagggcgacaggcctaggtatggt gacagggatggctaccgtggcggtcctcgtggtgcacctggtgactttgg tggtgagaaaggtggagcccctgcagagttccagccatcattcaggagct ctggtggtggcggctttggccgtggtggtggtggtggtgg
Download
page-top