Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ293280
Length 418 bp
Fasta Format > whsl31g21
cgtagcgcaagcagagtttagctcgctcccagcccggccgctcaccatgt ggaccaagaaggtggcgacgcaggtggttttggtcctgcttctcctcctc atcgcacaggaggcggcggtgccgggggcggaggcgaagatctgccggca gcgcagcgcggggttcaaggggccatgcgtgtcggacaagaactgcgcgc aggtctgcctgcaggaacgctggggcggcggcaactgcgacgggcccctc cgccggtgcaagtgcatcaggcagtgctgatcatatgtggaatgctacgg ctagctggccctcgccgtacgtcagctagctagcccatggagccatacgt ctgtgtacctacttgaatgtgtgtgtgtgtgtgtgtgcccccttatacgn acgtatgtcgtatgtata
Download
page-top