Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ649391
Length 181 bp
Fasta Format > whem16l03
cgcgacggtggtgaaggctgccggaatcaaggttgaggcctactggcccg cgctcttcgccaagctcctggagaagaggagcgtcgatgacctcatcctt tccgtcggatctggtggaggtggtgctccagctgctgctgctgctgcccc ggntgctggtggtgctgctgccgctgaagag
Download
page-top