Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ649350
Length 454 bp
Fasta Format > whem16i22
gtctgtcaggacctcgtgatgctgctcttcgagacctccctgctcacctc cggcttcagcctggaggaccccaacaccttcggcaccaggatccaccgca tgctcaagcttggcctgagcattgatgaggatgacgaggcgccagagaac gacaccgacatgccgcccctggaggacgacgccggcgagagcaagatgga ggaggtcgactaagcgccaaggctgcctgtcggctgtcgtcgtcagatgt ccatgccctgcaccgcctagttgtttttatcttagtgtcgacgttggatg gttttggcacgttttagctgtatcggttttgtcttttggctggccaaaca ttaagcgcggttagctgtttgtggtactcgtggaacagttcgttattgtt ggttctacaatatgtgttanttattatatttctatattcnctgctannaa aaaa
Download
page-top