Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ649144
Length 564 bp
Fasta Format > whem15n05
agaggcttttctgagaagctcaaatggctcccaaagttgctgttgccaag aagggcgatgccaaggcccaggccgccaaggttgccaaggctgtgaagtc tgggtcaatcaagaagacggcaaagaagatccgcacttctgtgacatttc accgccccaagaccctgtccaaggccagggaccccaagtaccccaggatc agcacccctggaaggaacaaattagaccagtaccagatcctcaagtaccc gcttaccactgagtctgcgatgaagaagattgaagacaacaacacccttg tcttcattgtcgacctcaaggccgacaagaagaaaataaaggctgctgtc aagaaaatgtatgacattcaggccaagaatgttaacaccctcatcaggcc tgatggcaagaagaaggcgtacgtgaagctgacaccagactacgatgctc ttgacgtggccaacaagatcggcatcatataagccagagggagggtcctg cagtangcgcttgtgtcgtggtttcttatgttattgnaattttgtanttg ttacttancnnang
Download
page-top