Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ293214
Length 703 bp
Fasta Format > whsl31c15
gctagggttttgggattttagcctccagcgccgccgccgccgcccagcga attcgacaagcccccgagctcgccggatccgatggccgtcacgttctccg acctccacaccgccgacgggctcaaggccctcgaggcgcacctcgccggc aagacctacatctccggcgatgggatcaccaaggacgacgtcaaggtgtt cgcggcggtgcccgtgaagcccagcgccgagttcctgaacgctgcccgct ggtacgacgccgtcgccgcggccgtttcttcaaggttccctggccaggcc tctggggtgagtgcatcctcggctcctgctgcagctgctcctgctgcttc caaggatgaagatgatgacgatgacatggatctgttcggcgatgagaccg aggaggacaagaaagcagcagctgagcgtgaggctgccaagcctgcaaag aagaaagaaagtggcaaatcctccgtcctcatggacatcaagccatggga cgatgagactgacatgaagaagttggaggaggctgtccgcagtgttcaaa tggagggtctcacctggggtgcatctaagcttatgcctgtgggttatggc atcaagaagctccagatcatgctgacgatcatcgacgaccttgtgtctgt cgacacccttattgaggaagtgctctgtgaggcgcccatcaacgagtatg tcc
Download
page-top