Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ648945
Length 660 bp
Fasta Format > whem15a08
tagttcagaggcttttctgagaagctcaaatggctcccaaagttgctgtt gccaagaagggcgatgccaaggcccaggccgccaaggttgccaaggctgt gaagtctgggtcaatcaagaagacggcaaagaagatccgcacttctgtga catttcaccgccccaagaccctgtccaaggccagggaccccaagtacccc aggatcagcacccctggaaggaacaaattagaccagtaccagatcctcaa gtacccgcttaccactgagtctgcgatgaagaagattgaagacaacaaca cccttgtcttcattgtcgacctcaaggccgacaagaagaaaataaaggct gctgtcaagaaaatgtatgacattcaggccaagaaggttaacaccctcat caggcctgatggcaagaagaaggcgtacgtgaagctgacaccagactacg atgctcttgacgtggccaacaagatcggcatcatataagccagagggagg gtcctgcagtaggcgcttgtgtcgtggtttcttatgttattggaattttg tanttgttacttancaaagggccttantggctccattgcctaccatatcg ctgcacactttcatgaatttgatgcaatcnaantgacttgtgttgatgct anaaaaaaaa
Download
page-top