Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ648895
Length 312 bp
Fasta Format > whem14n08
agctgctgtgcgagaacggacctgagctgtgtgcggtggtgtcataagga gcctatccatctccactagaattatcccaagtttcacttcacatcgtgat gttgttttacctttttcctgtcattgtcctgctataacggatagcgctcc ctgttggcgccgccgccggcggggatgccctagtggtggagggtgtatgt cctcttccgcggggtgcccctgcttgtacctagatggttactctttccgt ccattgtcaccggctaacattgtgataatatcagtctgggtaatgttaga ttaaaaaaaaaa
Download
page-top