Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ648852
Length 553 bp
Fasta Format > whem14k11
gccgccgcagccgcctcctgctacccgccgccgagatgacgaagcgcacc aagaaggccggaatcgtcgggaagtatggtaccaggtatggtgccagttt gcgtaagcagatcaagaagatggaggtgtctcagcactccaagtacttct gtgaattctgtgggaagtttgctgtgaagaggaaagctgttggaatttgg ggatgcaaggactgtggcaaggtcaaggctggcggcgcctataccatgaa cactgctagtgcagtcaccgtcaggagcacgatccgtcgcttgagggagc agaccgaagcatgattgccctactgttgtcttgaggaatccaggggttct gtagtggagtgaagacttaacaatctctgtattttggctatcgagcgatg gatatctgttantaattttggttctgattttangatctttgaaacttgaa agtatgtccctacanctgcctgttatgcnttatgccaacctatttgtatt tttgtgacncgtctctcnctctctacccctctgcnccccnnntcnntctt ata
Download
page-top