Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ648752
Length 621 bp
Fasta Format > whem14e08
cgatgatgacgagaaacctgctgctctggtaaagaaaacaccagccatcg aatctgacagctccgaaagtgactcagatgatagctcagatgaggatgtt cctgccaagactcctgctgctgctgccaagaaggtagattcttcagacag ttctgagtcggagagtgaatctgaggatgaggagaaatcaaagaaagccg cacaggccaccaagatagctcctgcagctgctaaaagaaaggaggagccc agtgattcctcagacagtgatgagagtgatgaagagcctccccagaaaaa gctgaaggatgctgcgaaggttactcctaagtctgccaaaaaggacagca ccagtgatgatgacagttctgatgaaagctctgatgatgagcctaaaaag aaagttacaactgccacaaaatcacagaaggaagagcctaaaactcctgc tagcaacaaaggtcaggcaacagggtcgaagaccctttggatggggaacc tttccttcaatattgagtatgatcaagtgaagcaattttttgcacaaatt ggagaggtcgttgatgttcgcctggctacccatgaanatggccatcccaa gggatttggtcatgttgantt
Download
page-top