Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ648229
Length 327 bp
Fasta Format > whem12f05
atggtggcggcaggtttggccggtctggtggccgtgatggcggcagagga ggcggccgaggctttcagagcagacagagtgctggcacagctagcgcagg gaagaagaccacatttggtgacgattagaaactttttgagccacaaaatg gtctgatgcaactgccgcgtgtctagacgactgtatccccgtgtttccca ttatcctagtggacctagtatcatttgtctgtagtattttcttgccgcta tatgttgtaatgccagaattctactatatatgttacacctagtgttttta taatacttcctctatccaaaaaaaaaa
Download
page-top