Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ648169
Length 463 bp
Fasta Format > whem12b17
gaagatgaggaggaatctgacaagtccaagtcggagatcaatgacgacga tgacgatgagggcagcgatgaggacgaggacgatgacgagtgaagaagac gcatcttgtcaaggctgctccggcggacaagtcgggagctgctgtgcgag aacggacctgagctgtgtgcggtggtgtcataaggagcctatccatctcc actagaattatcccaagtttcacttcacatcgtgatgttgttttaccttt ttcctgtcattgtcctgctataacggatagcgctccctgttggcgccgcc gccggcggggatgccctagtggtggagggtgtatgtcctcttccgcgggg tgcccctgcttgtacctanatggttactctttccgtccattgtcaccggc taacattgtgataatatcantctgggtaatgttanattaanctgttgtcc tccnnnanaaaaa
Download
page-top