Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ648130
Length 597 bp
Fasta Format > whem11p07
ctttgacccctttgccgaggcgaatgctggggacgctggtgcagctgccg gatcaaaagactacgttcatgtacgcatccagcagcgtaatggtcgcaag agcctgaccactgtccagggtctgaagaaggagttcagctacagcaagat cctcaaagacctcaagaaagagttttgctgcaatggtacagttgtccagg acacagaacttggacaggtcattcaactccagggtgatcagaggaagaac gtctcaaacttccttgtccaggccggcattgtgaagaaggaacacatcaa gattcatggtttctgagcaactgccagctccatatcagagtctacatgca aagcagctatatattggtggtgcagtatatttagttgtgtgctagcgcta gcaggcgttaccagcttgcgcgctctgagtatacagaaaatctagcatag cccacctctctgcgtgtatgcttgttaccgttgtgttgaaactttgtaag gagcaccatctttanatggcttgttaccctctcccatcaaggttgaataa tatatgctttgttaancgtggtatccttcntatcatcaaaaaaaann
Download
page-top