Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ648002
Length 587 bp
Fasta Format > whem11g11
tggcatctgctttgaggtctgtgatgttgttctgcacactgatgctattc acaggggtggtggtcaggtcatcccaacagcccggagggtcatttatgct tctcagctcactgctaagccaaggctactggagcctgtgtacctggttga gatccaggccccggagaatgcactcggcggtatctatggtgttctgaatc agaagagagggcacgtgtttgaggagatgcagaggcctggtaccccgctg tacaacatcaaggcttacctcccggtcatcgagtcgttcgggttctcaag taccctcagggctgcgacatctggccaggctttcccccagtgtgtgttcg accactgggacatcatgtcttcggatcctttggaggccggctcccagtct gcgacccttgtcacggagatccgcaagcgcaagggtctgaaggaacagat gacccctctatctgatttcgaggacaagctctaaacttttagttctgtta tcatatgggtctagtttgcttttgctgctaananagctgcactattattt tctgtctgttgantcntggcntgtattgctattgnga
Download
page-top