Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652043
Length 499 bp
Fasta Format > whem7h24
agattgctgagcttctgaggtaccactccaccaagagtggtgatgagctg acgagcctcaaggactatgtgaccaggatgaaggagggacagaacgagat ctactacatcactggtgagagcaagaaggctgtggagaactctcccttcc ttgagaagctgaagaagaagggctatgaggtcatctacatggttgacgcc attgatgagtatgccattggtcagctcaaggagtttgagggcaagaagct tgtctctgccaccaaggagggtctgaagcttgatgagagcgaggacgaga agaagaagcaggaggagctcaaggagaagtttgaggggctgtgcaaggtc atcaaggaggtgctgggcgacaaggttgagaaggttatcgtctctgaccg tgtggtggactccccttgctgtctggtgactggcgaatatgggtggaccg ccaacatggagaggatcatgaaggcccaggccttaagggactcgagcat
Download
page-top