Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652035
Length 642 bp
Fasta Format > whem7h14
ccagcgcctctccgcgatccaaatcctcccgggaaagatcttggttgatc tcttcctcctcgaccgcctcccaggttcttggtgcagcttttgccagtct cagcaggagatttcatgtctgatcttgacgttcagatcccaactgccttt gacccctttgccgaggcgaatgctggggacgctggtgcagctgccggatc aaaagactacgttcatgtacgcatccagcagcgtaatggtcgcaagagcc tgaccactgtccagggtctgaagaaggagttcagctacagcaagatcctc aaagacctcaagaaagagttttgctgcaatggtacagttgtccaggacac agaacttggacaggtcattcaactccagggtgatcagaggaagaacgtct caaacttccttgtccaggctggcattgtgaagaaggaacacatcaagatt catggtttctgagcaactgccagctccatatcanagtctacatgcaaagc agctatatattggtggtgcagtatatttagttgtgtgctancgctancan gcgttaccagcttgcgcgctctgantatacanaaaatctancatanccca cctctctgcgtgtatgcttgttaccgttgtgttgaaactttg
Download
page-top