Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ651507
Length 264 bp
Fasta Format > whem5c12
aggcaaggtaccccggctctacaacatcaaggcctacctccccgtcattg aatcctttgggttctcaagcaccctgagggccgcgacgtccggccaggcc ttcccccagtgtgtgtttgaccactgggacatcatggcttctgatccttt ggacccaggcacccagtcggcgacgctcgtcacggatatccgcaagagga agggcctcaaggagcagatgacccctctatccgatttcgaggacaagctc taaatttttgntgc
Download
page-top