Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ651488
Length 277 bp
Fasta Format > whem5b11
cgccttccaggnngagatcnacnanctcctctcgctcatcatcaacacct tctactccaacaaggagatcttcctccgcgagctcatctccaactcctcc gatgccttggacaagatcaggttcgagagcctcacggacaagagcaagct agacgcgcagcccgagctcttcatccacatcatccccgacaaggcgacca acacgctcacgatcgttgacagcggcattgggatgaccaagtccgacctc gtcaacaacctcgggaccatcgcnagg
Download
page-top