Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ651152
Length 558 bp
Fasta Format > whem3l07
ctcctgcagctgctaaaagaaaggaggagcccagtgattcctcagacagt gatgagagtgatgaagagcctccccagaaaaagctgaaggatgctgcgaa ggttactcctaagtctgccaaaaaggacagcaccagtgatgatgacagtt ctgatgaaagctctgatgatgagcctaaaaagaaagttacaactgccaca aaatcacagaaggaagagcctaaaactcctgctagcaacaaaggtcaggc aacagggtcgaagaccctttggatggggaacctttccttcaatattgagt atgatcaagtgaagcaattttttgcacaaattggagaggtcgttgatgtt cgcctggctacccatgaagatggccatcccaagggatttggtcatgttga gtttgctacggctgaagatgctcanaaagcgcttgattcactgaatggtg gagatctaatgggccgtccggtgagacttgacatggctgctgananangt gcaactcctcncnccnnggatggtggatcntttgnannnncnnnngnang tcccnncc
Download
page-top