Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ651099
Length 493 bp
Fasta Format > whem3i02
gccgccgcttcctcatctcccacctctcggctcgggagccggaagcgaaa ccccaaggtactgtagtcctggcgtgacattcaaaagcagtcaagatggt gaagttcacagcggaggagctccgtggaattatggataaaaagaataata ttcgtaacatgtctgttattgctcatgttgaccacggcaagtctacgctt acggattcccttgtggcagctgctgggattatcgcccaggaagttgctgg tgatgttcgcatgactgatacccgtgcagatgaggcagaacgtggtatta caatcaaatccacgggtatctctctgttctatcagatgactcctgaatca cttgagatgtacaagggcgacagggatggggatgaatacctgatcaacct tattgactcacctggtcacgttgacttctcttcggaagtgacagctgctc ttcgtatcactgatggtgctttggtggtggttgactgnnttga
Download
page-top