Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ650977
Length 623 bp
Fasta Format > whem3a11
tctcccttccttgagaagctgaagaagaagggctatgaggtcatctacat ggttgacgccattgatgagtatgccattggtcagctcaaggagtttgagg gcaagaagcttgtctctgccaccaaggagggtctgaagcttgatgagagc gaggacgagaagaagaagcaggaggagctcaaggagaagtttgaggggct gtgcaaggtcatcaaggaggtgctgggcgacaaggttgagaaggttatcg tctctgaccgtgtggtggactccccttgctgtctggtgactggcgaatat gggtggaccgccaacatggagaggatcatgaaggcccaggccttaaggga ctcgagcatggctggctacatgtcgagcaagaagaccatggagatcaacc ctganaacgccatcatggacgagctccgtaagcgtgccgatgccgacaan aacgacaagtctgtcaaggacctcgtgatgctgctcttcnagacctccct gctcacctccggcttcancctggaggaccccaacaccttcngcaccanga tccaccgcatgctcaagcttggcctgancattgatgangatgacnangcn ccananaacnacnccnacatgcc
Download
page-top