Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ650975
Length 568 bp
Fasta Format > whem3a09
cgccggcggaggagaggagacgcgggcgaggcaagaggagagtcaaatcc ccatcttgctcccccccccgcgccgccgaccccacccgcggcattctctc cggcgtccctcctccggccagggggaaaagcagcagcaggatggtgctgt gggtcttcgggtatgggtccctgatctggaaccccggattcgacttcgac gagaagatcctgggattcatcaagggatacaagcgaacgtttaatcttgc ttgcattgaccatagaggcacaccacagcatccggccaggacctgcaccc ttgaatccgaagatgaagccatatgctggggaattgcttattgtgtcaaa ggtggtctagaaaaagagcgagaagcaatgcagtacttggagagaagaga atgcnagtatgaccagaagatctctgtggatttctacaaggatggaaatt ctctggaaccagctgtgacggatgtattanttttcgtatccactcctgat ccanttggcaacaaatactatcttggccctgctgctttggaggatatggc aaggcaaattgctacanc
Download
page-top