Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ650285
Length 474 bp
Fasta Format > whem1d20
atcgcctcccaagatcgcagatctgctccggtgagaatccgtcgccatgt cttccagcgaggtcgcctgcacccttgccgccctcatcctccacgatgac gggatccccatcacttctgagaagatcgcgacggtggtgaaggctgccgg aatcaaggttgaggcctactggcccgcgctcttcgccaagctcctggaga agaggagcgtcgatgacctcatcctttccgtcggatctggtggaggtggt gctccagctgctgctgctgctgccccggctgctggtggtgctgctgccgc tgaagagaagaaagaagagaaaaaggaggaggctaangaanagagcgatg atgacatgggcttcancttgttcgactaagcagttcaattccagttctcc tgtggaatcttttatgctaaggattacttatcttatgtgcttttangtcn aattttgcggatttantatgtttg
Download
page-top