Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ650248
Length 350 bp
Fasta Format > whem1a11
tatgctgctgtctaatgcttatacagcggagaggaggtgtccgaggagcc gaccccaatggctctgtctacgcagccgtggattggatgcacaattgttt cacttcgcaaacaacagccatgtcaggaagccatgatctggagtggtcat cgctcaataaaaatggatgcagcaaaacccccattgaagaaacgtgctag aagccagctccacattcggctaacctgaaccttcatcgctacctaggtat ggctgccaagtttcctttagtaatgtatatgcatcatgttcagacatgcc tgcaaggctccatctaggtagatgttacgtactctagcttcccnccacta
Download
page-top