Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ537391
Length 767 bp
Fasta Format > rwhei20p13
ggcagggaataaactaaatatttagttttaaactcataacctccatccag aaagtaacacgaacaaaataagataactgaacgctggctaggaatgtcga cagaagtactcaagaaatcagccatcaaaactgactacaaagttcacgac acccaggtggcacatatatcatcttctagatatgaagcagcaaaatagcg acttctattttctactcagcagcagcaacctcctccgctccaggaatcac ctcatctccatcagcaggcctgtcaagcttcacaccaacatcctccttgt agtcaccgtgcacctccatgagcttccccaggtcaaacttgggggccttc aggatcttcaccttgcggacgtacacgttctggagggggaagatgcttga ggtggccttctcaatctcctttccaatcacctcagggatgaacttgttca caagctccttcaagtcacagcttgcagcttggttgaccatgatctcaacc atcttgcggcggatctgtctgatctgacttgcttgggcatagcaagtgcg cttcacctggtttgggcgtctcttcgtgaagccaatggtgaacatgcgga gcatgtagttgtcagtggtcttcacatccacatgagcctcaatgagtgtc tgccacttcctcacaagagacctgagcttgtcagtggtgaagtccatgcc ccanaagtttgtgaggacattcatcccttgcacatcctcagcacggagtc tgatcttcctgtaggcc
Download
page-top