Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536883
Length 756 bp
Fasta Format > rwhei19o04
tgagtcgccaaatgcatttattattagggtatcacaagggaagcaataac acttgaagtcttaggctttcgcattagcactctggaagctacagcctttg ccacaatagttgccaaagaaaattagcgcacaccctcaatggtgccagag ctgaagtaaaccacagatctttcaatggtagaatgtcaagagtgagtgtg gtcagaggaaaatgccatctctttcgctgatccagccgtgctgctcttct tactatgttgaaaccgcaacggtgccctcaggaagagcagagatgtgcac aacaggtgtatgcgattttaatggtatgtcggagccggtaaccttcttct ccgtcgacctgctcagcaccttcctcacctcatccgcaagcacaatgatc gagtcgtcttcatggcttatattggacagtgccttctccattgagaacag gtagtccctattatatccattagggccactggctgtagcaatttgccttg ccatatcctccaaagcagcagggccaagatagtatttgttgccaactgga tcaggagtggatacgaaaactaatacatccgtcacagctggttccagaga atttccatccttgtagaaatccacagagatcttctggtcatactcgcatt ctcttctctccaagtactgcattgcttctcgctctttttctagaccacct ttgacacaataagcaattccccagcatatggcttcatcttcggattcaag ggtgca
Download
page-top