Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536109
Length 702 bp
Fasta Format > rwhei17c08
gtcgacagaagtactcaagaaatcagccatcaaaactgactacaaagttc acgacacccaggtggcacatatatcatcttctagatatgaagcagcaaaa tagcgacttctattttctactcagcagcagcaacctcctccgctccagga atcacctcatctccatcagcaggcctgtcaagcttcacaccaacatcctc cttgtagtcaccgtgcacctccatgagcttccccaggtcaaacttggggg ccttcaggatcttcaccttgcggacgtacacgttctggagggggaagatg cttgaggtggccttctcaatctcctttccaatcacctcagggatgaactt gttcacaagctccttcaagtcacagcttgcagcttggttgaccatgatct caaccatcttgcggcggatctgtctgatctgacttgcttgggcatagcaa gtgcgcttcacctggtttgggcgtctcttcgtgaagccaatggtgaacat gcggagcatgtagttgtcagtggtcttcacatccacatgagcctcaatga gtgtctgccacttcctcacaagagacctgagcttgtcagtggtgaagtcc atgccccagaagtttgtgaggacattcatcccttgcacatcctcagcacg gagtctgatcttcctgtaggcctggtcctcatcgttctgaagatcagcta na
Download
page-top