Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ535391
Length 433 bp
Fasta Format > rwhei14g11
acatatagcggcaagaaaatactacagacaaatgatactaggtccactag gataatgggaaacacggggatacagtcgtctagacacgcggcagttgcat cagaccattttgtggctcaaaaagtttctaatcgtcaccaaatgtggtct tcttccctgcgctagctgtgccagcactctgtctgctctgaaagcctcgg ccgcctcctctgccgccatcacggccaccagaccggccaaacctgccgcc accatcacggccaccagaccggccaaacctgccgccgccatcacggccac cagaccggccaaacctgccaccaccagagcggccaccatctctgccacca gatcgaccaccaacgccaccaaattgacccttaggcttagcttcggcaac atacaagttgcagccacctaggtcagatccact
Download
page-top