Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ535377
Length 710 bp
Fasta Format > rwhei14f15
ctcctcatcacgatgtcgatagcagagatcacaaattcatctagaaaatc ctaaaacacaggtttttgtccatagggtagatatagcagatcgcatcaga tgctagatatccattaatgcctcacaaaatatgaactttaagccacaaag acatctcaagggagcatcctagtctactcccagccttgagcagggggttg caccgcggcgtcccagccagtagcagccacaacaggagcaggaacggcac cttccacagcaacaggtgcccctgctgcatcccatccatcgccaccagca actggagcttcagccatcggccactcgccaccagtaacaggcgggggagc aggtgcatcagaggtccactggtcaccaccccattgaccagctgcagctc cgtaatcagtgatggcagcatactctggggctccagcagcttcatcctcc tgctccttggcttcctcagggtccctgtagaagaacagatcaaccatgac atcccacttgtgcccaggcaggatagtacccctcatctgcagaaccatcc tggccaagagccagtacaggcagccaatgctgttcctccccttgttgttt gctgggatgccgatatcgacgtatcgcatgggagagtcagtgtcacagaa ggcaatggtagggatgttccccagagcagactccttgatgggctggtggt cagtccttgg
Download
page-top