Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ535338
Length 698 bp
Fasta Format > rwhei14d08
agcaggccgcgtggtatgcgttcaatctgtacacctttttgcacaaaatg cacaaagattattaacctgcgcggaattttcataccactctgctttgttc aagggcgtgactgacaaagaaatttcgacatgggaaagaatgaaagacac ggaaattgagccggtccgcggcccagagttccggggcagcaggcaggcta tgcagtcgattattaatccagtcggtcctcgctacccttccagtgatgca gcagccacctcctttccatcatcagagaagtagtcttgccttattttacg ggaaagctggtacaggcctgtgccggccatcgcaacgttaacgctgaaaa ggttccagtttttcggtgtgataaccatgctgtagcgtgaccagacgact ccagtgcaggcaacagcgatttgctgaggataggatatcttttctggagg cttagcaaagtcggcaatgttcgcaatgctgatcccccatttaaatgttg gagcccaaaaatgaatagttttggggccggcgggatggttcaagaaggct tgaatctttgaagccattcaatcaaatggacgcgcactttcctgtccttt tgcacaaccctgcttaattactgtcctgtacacctgggagggacgcccgc cgccggtcgccggtcgccggtcgaggtcgaggtcgcggtcgccggagc
Download
page-top