Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ535304
Length 260 bp
Fasta Format > rwhei14a24
acaacttctcggttcagcaacaaacttcaacttctctaggtaacatcatc atcataataataatacttgctactactgctactaataattcccggtcgct gcaaaggccacgtcacaaaagctcagcaacaaaaaatacagcatggcgcc tcagctagagcagcacccgcccttcttcaccgccgagacatcgtccttca tgttgatcttctcacccttgccagggccagcggccgagtcttcacccgcc tcgaccgccc
Download
page-top