Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ535220
Length 636 bp
Fasta Format > rwhei13l15
caacaaagtagttgccatcatcgatggtcaaaattaattacatatgggca caccatcgagtagaaagaaagctactcgtaattaattagacagcgggcgg aatcgatccggccggagcactgtccacaaacatctgacggagcaattcct tggacggccaccgcggcttgccatcttctcctaggccttggaagtcttcc aacggaggcggcggcttgggcatcatcggcgcagacgccggcgccggcgc cggngccggcgagggcagatacttcngcagaagcaggttctcgccatccc cctcnagcagagaaggcatggcaacaagcctcctcttcnccggcgccggc gagcgcanatacttcancanaancangttctcgccatccccctcnancan anaangnatggnaacnancctcctcttccncgtcccctggngcacatccn tggnttccctctcctctcctctggnnnnntannttgattcttcttctctc ctgnggnttcncntcnngnnnaattcntgnnnnnnnnnngatnnnntann tntanannnnnnnnnnnnnnnnngnanntnnnnnttntnntnnnttnnnn gngnnnanttnnnnnnttnnnnnnntnntnnnnnna
Download
page-top