Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ535051
Length 556 bp
Fasta Format > rwhei13b24
cgtcgccgccaccgatcagttcttggctgccaccgcttccgcctgcacgg gtgcctccgtgttcatctccttcattttctgaccgatctcatcgacggcg gcgggggcgggggcgacggcggcccccttgggcttctctgctgcctcctc cttcggcttctctgctgaatcctcctccttctcgtctttcttgtcggtgc tctctttctctgtcttcttcttgagacgtccggtgacgggcacggccagg gcgtcagtggcctcgaatgcctccacggggaagctgcgggagaggccgcc gatggccttgcagtggagcttgccggtgggcgggtcgtcgacgcagatct cgtggaggttgacccanatgagcatctccttggccttgacgccggagatc ttcttcaggcggcccttctcggcgatggcggagacctcngtggcgtanga gacgtggcggccggccttggcgaaataatggtccacccncttcttctgct tganccacacnaanccggtctcctccanntanccnnactcnatgatgtcc ttganc
Download
page-top