Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ535019
Length 576 bp
Fasta Format > rwhei12p23
acgagtcagcggaagcaacaatatctgagtacagacataagttaaacaag ttgccataagatggctagcacaaactgggatacagattgaaagaggcgca ggcctcctgcctgggatcctcctaactactcctggtcgtcgtcagcggcc tgcacgtagtagtaggctcctctagtgtagtagtcgtcgtcgacggtagc gtctggatcctggttgctctggcaaggaggaggggtcatcaactccgtag tcgaactgggcagcaacatcgtcggtctcgtagtcgcgatgtcgtaggcg agctcgggaaggtcgggttgtggagcgacggcgatgaattcgtcgatgat gtcgcggtggctggaggttgaagacgacatcgatccctgcgatccagggg ctaccggctccaactggtggacatagtcgaaggagtggacgtcggcgaag ctcgtanacgaggtggctgggcgtggtgagctcggtggctacgggggcag cgaggcaatggccgcggcanaggcggccatgcnaggaanaggaanaanca actcnaggcgganaanggaaaaggtc
Download
page-top