Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ534899
Length 743 bp
Fasta Format > rwhei12g22
agaagatcacttctagctgattccggacagcacacaaacaacacaaggct tcaccggctcgtaggttctagcgccttaaaactaggggtagcagcagagg gcagcaagactgttcgattatacactcgaggagttcacaaaaaggccagg accgagacgtccgaaatgtgagcctatgtctcccttcgcgaccttctgcg tggcaccgtcgtgtcatcctctttctcctccttgtcgccgctgcttccag cggcatcggcttccgtggcactgggcttcttgacctcggcaacgggcttc acaggtgccactggcttcttgccaccgaaaatggttctgaagagtacagt cacaaggatgacagcgactgaggccaagatcgaaattgtaatgttgggct gcttctctcccttctcaataatatcaatgatctttatcttgtaaggttcc aagaatggaatgtcggcgattttgtacaaaacactgaagatcttcttctg gaactcagaaaggtcttctgaatcggctgctgcagcctcctcagccttct gcttttccttctcaacatcaaacttgggtttccatgtcttctccaagatg gcggtggctaccttctcatcatcggcgataagaatgttgtcaaaaaggat gccatcctgcattgtccagatctcaattccaatagcggcaatcggatcaa agtcaggcttgtcaagctcaaagtattcagggttggggatttc
Download
page-top