Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ534654
Length 556 bp
Fasta Format > rwhei11f20
attttcattctaaaaagaccatcccaaggtggtttgcagtactcattgca cagatacttaggtctcaaacatattaaatccgcaaaattcgacctaaaag cacataagataagtaatccttagcataaaagattccacaggagaactgga attgaactgcttagtcgaacaagctgaagcccatgtcatcatcgctctct tccttagcctcctcctttttctcttctttcttctcttcagcggcagcagc accaccagcagccggggcagcagcagcagcagctggagcaccacctccac cagatccgacggaaaggatgaggtcatcgacgctcctcttctccaggagc ttggcgaagagcgcgggccagtaggcctcaaccttgattccggcagcctt caccaccgtcgcgatcttctcagaagtgatggggatcccgtcatcgtgga ggatgagggcggcaagggtgcaggcgacctcgctggaagacatggcgacg gattctcaccggagcagatctgcgatcttgggaggcgatggaagtggagg cgcagg
Download
page-top