Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ534551
Length 243 bp
Fasta Format > rwhei10o05
gntctcaaactccttcttgactggtgttgcatcagaaggagaagcttgat atggtgcctttgcatgcagacgatcctttctcttctcaaggaatcggtga agtgacncctttctagcaattggcanatcagaagcattcggacgagcaga cttaggagcaacaaccggatcactaggcaaactacttgccggggccanca cggccgtctggaccttggcggtgtctgcagcagttgtggtcgc
Download
page-top