Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ539236
Length 768 bp
Fasta Format > rwhei9b18
atatctagtaaacatccgttacatcaccagacatcaaaacatagttccca gtatcacgacaagtaggtcataacagcaagactcatcgatacaaaatagt gcagctctctttaacaacacaagaccaggtaagggataacagcaccaaaa atttagagcttgtcctcgaaatcggatagaggggtcatctgctccttgag gcccttcctcttgcggatatccgtgacgagcgtcgccgactgggtgcctg ggtccaaaggatcagaagccatgatgtcccagtggtcaaacacacactgg gggaaggcctggccggacgtcgcggccctcagggtgcttgagaacccaaa ggattcaatgacggggaggtaggccttgatgttgtagagcggggtacctt gcctctgcatctcctcgaacacgtgccctctcttctgattcagaacacca tagataccaccaagcgcattctccggggcctggatctcaaccaggtacac aggctccagcagccttggcttggcagtcagctgagaagcataaatgaccc tcctggccgtgggaatgacctgaccaccacccctgtggatagcatcagtg tggagaacaacatcacagacctcaaagcaaatgccacgcatgttctcctc agccaacgcgccttcctttgacgcccactggaaaccagccacaacagagt ccttgatttcattaagatactgcactcccttacacatgtcgacgaccatg gttggggccagtcgtctc
Download
page-top