Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ539196
Length 758 bp
Fasta Format > rwhei8o23
ataacacttgaagtcttaggctttcgcattagcactctggaagctacagc ctttgccacaatagttgccaaagaaaattagcgcacaccctcaatggtgc cagagctgaagtaaaccacagatctttcaatggtagaatgtcaagagtga gtgtggtcagaggaaaatgccatctctttcgctgatccagccgtgctgct cttcttactatgttgaaaccgcaacggtgccctcaggaagagcagagatg tgcacaacaggtgtatgcgattttaatggtatgtcggagccggtaacctt cttctccgtcgacctgctcagcaccttcctcacctcatccgcaagcacaa tgatcgagtcgtcttcatggcttatattggacagtgccttctccattgag aacaggtagtccctattatatccattagggccactggctgtagcaatttg ccttgccatatcctccaaagcagcagggccaagatagtatttgttgccaa ctggatcaggagtggatacgaaaactaatacatccgtcacagctggttcc agagaatttccatccttgtagaaatccacagagatcttctggtcatactc gcattctcttctctccaagtactgcattgcttctcgctctttttctagac cacctttgacacaataagcaattccccagcatatggcttcatcttcggat tcaagggtgcaggtcctggccggatgctgtggtgtgcctctatggtcaat gcaagcaa
Download
page-top