Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ538713
Length 771 bp
Fasta Format > rwhei7b11
cagatagcaatagttcaacagatatgcctcgacataaaggttctagcaca agcttcaagtagtctcagaacgaaggtagcaaaacctgatggctcaaaca aaatactatcaaggtgtgcatagggcagcttaacggtagcggcggaggga gacggtctggttgcgcttccaggtggctctccttgagggcctgttcttgt ggtggcggtggcccttgccacgcagaccacggaatttctttcccgccgac gtgagtccgcgaagctcacggtgcttgtgcacgggcttgcagagccagtt gatccttgggtcgttgcggacagcactgtgagcaacatcaacaaggatga cctcaaagtacttgtaggtagagtcctcattcacccagtaggagttgagc acacgaagaccacccagcctgcgcccagctctttcttcagcaacagacct cttgttcctctggaacttgagctgggtaataccctggtgcttgggcttac catagacaatacccttgggcactggcctcttcctgccaccacgcctgaca cggatacggtagaccacatacccctgcttggccttgaagccgagacggcg agccctgtcggggcgggtgggcctggtgatgcncacgatggccggctgct gcctgtactcccancaacgcacgcgctgcacnaacctcatcacntccgac tgcttcctcctccatanctccnacacnaacttgtacncncccatggctgc ngctgcggctgcngcggnaaa
Download
page-top