Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ538707
Length 713 bp
Fasta Format > rwhei7a23
cagcctttgccacaatagttgccaaagaaaattagcgcacaccctcaatg gtgccagagctgaagtaaaccacagatctttcaatggtagaatgtcaaga gtgagtgtggtcagaggaaaatgccatctctttcgctgatccagccgtgc tgctcttcttactatgttgaaaccgcaacggtgccctcaggaagagcaga gatgtgcacaacaggtgtatgcgattttaatggtatgtcggagccggtaa ccttcttctccgtcgacctgctcagcaccttcctcacctcatccgcaagc acaatgatcgagtcgtcttcatggcttatattggacagtgccttctccat tgagaacaggtagtccctattatatccattagggccactggctgtagcaa tttgccttgccatatcctccaaagcagcagggccaagatagtatttgttg ccaactggatcaggagtggatacgaaaactaatacatccgtcacagctgg ttccagagaatttccatccttgtagaaatccacagagatcttctggtcat actcgcattctcttctctccaagtactgcattgcttctcgctctttttct agaccacctttgacacaataagcaattccccagcatatggcttcatcttc ggattcaagggtgcaggtcctggccggatgctgtggtgtgcctctatggt caatgcaagcaag
Download
page-top