Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ538576
Length 257 bp
Fasta Format > rwhei6i06
ggtccactggtcaccaccccattgacnagctgcagctccgtaatcagtga tggcagcatactctggggctccagcagcttcatcctcctgctccttggct tcctcagggtccctgtagaagaacagatcaaccatgacatcccacttgtg cccaggcaggatagtacccctcatctgcangaaccatcctggccaanagc cagtacaggcagccaatgctgttcctcccccttgttgnttgctgagatgc cgatatc
Download
page-top