Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ538437
Length 389 bp
Fasta Format > rwhei5p02
acatagttcccagtatcacgacaagtaggtcataacagcaagactcatcg atacaaaatagtgcagctctctttaacaacacaagaccaggtaagggata acagcaccaaaaatttagagcttgtcctcgaaatcggatagaggggtcat ctgctccttgaggcccttcctcttgcggatatccgtgacgagcgtcgccg actgggtgcctgggtccaaaggatcagaagccatgatgtcccagtggtca aacacacactgggggaaggcctggccggacgtcgcggccctcagggtgct tgagaacccaaaggattcaatgacggggaggtaggccttgatgttgtaga gcggggtaccttgcctctgcatctcctcgaacacgtgcc
Download
page-top