Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ537631
Length 694 bp
Fasta Format > rwhei2m20
gtcgacagaagtactcaagaaatcagccatcaaaactgactacaaagttc acgacacccaggtggcacatatatcatcttctagatatgaagcagcaaaa tagcgacttctattttctactcagcagcagcaacctcctccgctccagga atcacctcatctccatcagcaggcctgtcaagcttcacaccaacatcctc cttgtagtcaccgtgcacctccatgagcttccccaggtcaaacttggggg ccttcaggatcttcaccttgcggacgtacacgttctggagggggaagatg cttgaggtggccttctcaatctcctttccaatcacctcagggatgaactt gttcacaagctccttcaagtcacagcttgcagcttggttgaccatgatct caaccatcttgcggcggatctgtctgatctgacttgcttgggcatagcaa gtgcgcttcacctggtttgggcgtctcttcgtgaagccaatggtgaacat gcggagcatgtagttgtcagtggtcttcacatccacatgagcctcaatga gtgtctgccacttcctcacaagagacctgagcttgtcagtggtgaagtcc atgccccagaagtttgtgaggacattcatcccttgcacatcctcagcacg gagtctgatcttcctgtaggcctggtcctcatcgttctgaanat
Download
page-top