Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ537441
Length 768 bp
Fasta Format > rwhei2c13
ggcattcaacatatagcggcaagaaaatactacagacaaatgatactagg tccactaggataatgggaaacacggggatacagtcgtctagacacgcggc agttgcatcagaccattttgtggctcaaaaagtttctaatcgtcaccaaa tgtggtcttcttccctgcgctagctgtgccagcactctgtctgctctgaa agcctcggccgcctcctctgccgccatcacggccaccagaccggccaaac ctgccgccaccatcacggccaccagaccggccaaacctgccgccgccatc acggccaccagaccggccaaacctgccaccaccagagcggccaccatctc tgccaccagatcgaccaccaacgccaccaaattgacccttaggcttagct tcggcaacatacaagttgcagccacctaggtcagatccactaagctcaag tgctttcgaaaaggaactctcatcagtaaaatccatgtaagctatccctt tgcttgcaccattctcataatccatcggaactgagacacgtgtgatttct ccacatttagagaagtgttcttgaagagagctccgaatagcatcctcctg ttgagatgaatcaaaacccttgacaaatactgagaggctgggacctccac ttggttttccaaacgatccaccatccctggtgcgaggagttgcacctctt tcagcagccatgtcaagtctcaccggacggcccattanatctccaccatt cagtgaatcaagcgcttt
Download
page-top