Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ537107
Length 709 bp
Fasta Format > rwhei1l10
atagttcacagatatgcctcgacataaaggttctagcacaagcttcaagt agtctcagaacgaaggtagcaaaacctgatggctcaaacaaaatactatc aaggtgtgcatagggcagcttaacggtagcggcggagggagacggtctgg ttgcgcttccaggtggctctccttgagggcctgttcttgtggtggcggtg gcccttgccacgcagaccacggaatttctttcccgccgacgtgagtccgc gaagctcacggtgcttgtgcacgggcttgcagagccagttgatccttggg tcgttgcggacagcactgtgagcaacatcaacaaggatgacctcaaagta cttgtaggtagagtcctcattcacccagtaggagttgagcacacgaagac cacccagcctgcgcccagctctttcttcagcaacagacctcttgttcctc tggaacttgagctgggtaataccctggtgcttgggcttaccatagacaat acccttgggcactggcctcttcctgccaccacgcctgacacggatacggt agaccacatacccctgcttggccttgaagccgagacggcgagccctgtcg gggcgggtgggcctggtgatgcgcacgatggccggctgctgcctgtactc cccagcaacgcacgcgctgcacgaaacctcatcncgnccgactggcttcc tcctccata
Download
page-top