Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ537012
Length 680 bp
Fasta Format > rwhei1f20
caaacacttgacaacagaaccgacagtaatatgcacagataaataaagtt ttacaattttacccagaacagaaaacacaggtgcacaaaggctacacagt atcttgacaaagcaacaggctgtaagcagtagtgaaaaacatataagaca tgcttacttagcacaacaggctatggggggtgggggttaaattgaatact cctacttgagcggtgacgacaggcatctcgcagccggtttcttctttcac tggatatgctgttcttccagtttgtcctttcactggacgtgcttgctatt cttcttccatctctgtggtcctgtggagcgcactgctcaggaggagtcat gagctgggctgtccgaatgcatgtccatggatgagtcgtttgaagccgtg ggattaggctcgcgggctaagccgtttgcaaagtagcctgcatccccgcc ctgatccagatggtatggttggaggccccggcgcacggggctggatagtg cgttggaaaagaccgccgagttcttgggctgcgtcaaccctgggtttcct agtgcaaataagcttgcagatggttgatggttgcttgtgttgggcatatg cacagtancctgagtgctttggcttgcatattgtgatcttgganaggcca acggattgtcgcctccatactgaatctcnt
Download
page-top