Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ537005
Length 438 bp
Fasta Format > rwhei1f09
aatcgatataaggtggcaacattatcagatagatatatggaattcaaatt cagaacgagttgatgagagcaaccaaatcactgagatgcgtgtgggacga cccacgctcgttgatgccatcctccgcggccatcttcagccccttcatcc tctccctgatctcccgcccctctccgctctccatcatcctctcaatggcg gccttgatcctccctctctccagccggtgcgagccgtcgacctccacgcc caccctccagacgtcggccacgtacctggcgttgccgtactggtcgccgt gcagcgggtggcagatcatcggcacgccctccgcgatcgcctccaccgtg gagttccagccgctgtgggtgaagaaggcgcccaccgccgggtgcgccag cacctcctcctgcggcgcccagcccacgatcatgccgc
Download
page-top